Upregulation of TET1 contributes to the activation of lncRNA HULC in LO2 cells treated with silver nanoparticles

doi:10.20199/j.issn.1672-2302.2024.05.008

Abstract

Abstract:

Objective To explore the impact of silver nanoparticles (AgNPs) on the expression of DNA demethylation enzyme, specifically ten-eleven-translocation proteins (TETs) family and the molecular mechanism underlying the regulation of long non-coding RNA HULC. Methods Human normal liver cells (LO2) were treated with silver nanoparticles (AgNPs) at concentrations of 0 (blank control group), 5, 10 and 20 μg/mL. Additionally, LO2 cells were treated with 10 μg/mL AgNPs in combination with the DNA methyltransferase inhibitor 5-azacitidine (5-azaC) and the histone deacetylase inhibitor trichostatin A (TSA) for 24 hours. qRT-PCR was employed to assess the mRNA expression levels of long non-coding RNAs (lncRNAs) HULC, HOTAIRM1, H19 and MALAT1, as well as the expression of the DNA methyltransferases (DNMTs) and TETs families. Western blot (WB) was utilized to evaluate the protein expression levels of the DNMTs and TETs families. Furthermore, RNA interference (siRNA) technology was employed to silence the expression of TET1 in order to further investigate the regulatory relationship between TET1 and lncRNA HULC. Results qRT-PCR results showed that compared to the blank control group, the mRNA expression of H19 was downregulated in all concentration groups (t=7.250, 6.876, 5.077, all P<0.05). In the 20 μg/mL AgNPs group, the mRNA expression of lncRNA HULC was upregulated, while HOTAIRM1 expression was downregulated (t=12.250, 12.850, both P<0.05). After TSA intervention, the expression of lncRNA HULC was upregulated, and H19 expression was downregulated (t=12.970, 12.950, both P<0.05). Compared with the control group, the expression of TET1 and TET3 in the 20 μg/mL AgNPs group was up-regulated (t=6.909, 15.551, both P<0.05). After TSA intervention, TET1 expression was upregulated and TET3 was down-regulated (t=17.224, 3.602, both P<0.05). WB analysis revealed that compared to the blank control group, the protein expression of DNMT1 and DNMT3a was upregulated in all concentration groups, while DNMT3b protein expression was downregulated (t=5.968, 2.518, 4.010; t=8.983, 16.230, 14.260; t=23.000, 41.630, 49.300, all P<0.05). After 5-azaC and TSA intervention, DNMT1 protein expression was downregulated, and DNMT3a protein expression was upregulated (t=3.111, 3.695; t=30.740, 62.790, all P<0.05), while DNMT3b expression showed a downregulation and upregulation trend respectively (t=7.024, 3.372, both P<0.05). The protein expression of TET1 was upregulated in all concentration groups (t=5.869, 7.519, 10.470, all P<0.05). Successful construction of TET1-silenced cell model, the expression of TET1 protein and lncRNA HULC mRNA in si-TET1-3 group (TET1 gene silenced group) was lower than that in si-NC group (silencing control group) (t=3.297, 4.708, both P<0.05). Conclusion With the increase in AgNPs concentration, the expression of lncRNA HULC and DNA demethylase TET1 in cells is significantly upregulated. The addition of 5-azaC and TSA can effectively alter their expression levels, indicating that lncRNA HULC is likely influenced by DNA methylation.

Key words: Silver nanoparticles (AgNPs), LncRNA, HULC, DNA demethylase

CLC Number:

JIAO Qunfang, LI Huifang, ZHENG Dongyan, HUANG Hao, ZHONG Qinghua, CAI Xiaonan, LING Xiaoxuan, LIU Linhua. Upregulation of TET1 contributes to the activation of lncRNA HULC in LO2 cells treated with silver nanoparticles[J]. Journal of Tropical Diseases and Parasitology, 2024, 22(5): 294-300.

Figures/Tables 8

Table 1

Table 2

Table 3

Table 4

Figure 1

Table 5

Table 6

Figure 2

References 37

[1]	Huq MA, Ashrafudoulla M, Rahman MM, et al. Green synthesis and potential antibacterial applications of bioactive silver nanoparticles: a review[J]. Polymers, 2022, 14(4):742.
[2]	Tăbăran AF, Matea CT, Mocan T, et al. Silver nanoparticles for the therapy of tuberculosis[J]. Int J Nanomedicine, 2020,15:2231-2258.
[3]	Nie P, Zhao Y, Xu H. Synthesis, applications, toxicity and toxicity mechanisms of silver nanoparticles: a review[J]. Ecotoxicol Environ Saf, 2023,253:114636.
[4]	Yin IX, Zhang J, Zhao IS, et al. The antibacterial mechanism of silver nanoparticles and its application in dentistry[J]. Int J Nanomedicine, 2020,15:2555-2562.
[5]	Li N, Georas S, Alexis N, et al. A work group report on ultrafine particles (American academy of allergy, asthma & immunology): why ambient ultrafine and engineered nanoparticles should receive special attention for possible adverse health outcomes in human subjects[J]. J Allergy Clin Immunol, 2016, 138(2):386-396.
[6]	Li JY, Chang XR, Shang MT, et al. The crosstalk between DRP1-dependent mitochondrial fission and oxidative stress triggers hepatocyte apoptosis induced by silver nanoparticles[J]. Nanoscale, 2021, 13(28):12356-12369. doi: 10.1039/d1nr02153b pmid: 34254625
[7]	Cameron SJ, Hosseinian F, Willmore WG. A current overview of the biological and cellular effects of nanosilver[J]. Int J Mol Sci, 2018, 19(7):2030.
[8]	Yuan YG, Zhang YX, Liu SZ, et al. Multiple RNA profiling reveal epigenetic toxicity effects of oxidative stress by graphene oxide silver nanoparticles in-vitro[J]. Int J Nanomedicine, 2023,18:2855-2871.
[9]	González-Palomo AK, Saldaña-Villanueva K, Cortés-García JD, et al. Effect of silver nanoparticles (AgNPs) exposure on microRNA expression and global DNA methylation in endothelial cells EA. hy926[J]. Environ Toxicol Pharmacol, 2021,81:103543.
[10]	Klec C, Gutschner T, Panzitt K, et al. Involvement of long non-coding RNA HULC (highly up-regulated in liver cancer) in pathogenesis and implications for therapeutic intervention[J]. Expert Opin Ther Targets, 2019, 23(3):177-186.
[11]	Shaker O, Mahfouz H, Salama A, et al. Long non-coding HULC and miRNA-372 as diagnostic biomarkers in hepatocellular carcinoma[J]. Rep Biochem Mol Biol, 2020, 9(2):230-240.
[12]	Xin XR, Wu MY, Meng QY, et al. Long noncoding RNA HULC accelerates liver cancer by inhibiting PTEN via autophagy cooperation to miR15a[J]. Mol Cancer, 2018, 17(1):94.
[13]	Andrews S, Krueger C, Mellado-Lopez M, et al. Mechanisms and function of de novo DNA methylation in placental development reveals an essential role for DNMT3B[J]. Nat Commun, 2023, 14(1):371. doi: 10.1038/s41467-023-36019-9 pmid: 36690623
[14]	Zhang HQ, Yuan Q, Pan ZJ, et al. Up-regulation of DNMT3b contributes to HOTAIRM1 silencing via DNA hypermethylation in cells transformed by long-term exposure to hydroquinone and workers exposed to benzene[J]. Toxicol Lett, 2020,322:12-19.
[15]	Joshi K, Liu SH, Breslin S J P, et al. Mechanisms that regulate the activities of TET proteins[J]. Cell Mol Life Sci, 2022, 79(7):363. doi: 10.1007/s00018-022-04396-x pmid: 35705880
[16]	Huang WX, Li H, Yu QS, et al. LncRNA-mediated DNA methylation: an emerging mechanism in cancer and beyond[J]. J Exp Clin Cancer Res, 2022, 41(1):100. doi: 10.1186/s13046-022-02319-z pmid: 35292092
[17]	Zhang DY, An XL, Li ZY, et al. Role of gene promoter methylation regulated by TETs and DNMTs in the overexpression of HLA-G in MCF-7 cells[J]. Exp Ther Med, 2019, 17(6):4709-4714. doi: 10.3892/etm.2019.7481 pmid: 31086605
[18]	Qian H, Zhao JQ, Yang XY, et al. TET1 promotes RXRα expression and adipogenesis through DNA demethylation[J]. Biochim Biophys Acta BBA Mol Cell Biol Lipds, 2021, 1866(6):158919.
[19]	Ghafouri-Fard S, Abak A, Talebi SF, et al. Role of miRNA and lncRNAs in organ fibrosis and aging[J]. Biomedecine Pharmacother, 2021,143:112132.
[20]	Li YQ, Sun N, Zhang CS, et al. Inactivation of lncRNA HOTAIRM1 caused by histone methyltransferase RIZ1 accelerated the proliferation and invasion of liver cancer[J]. Eur Rev Med Pharmacol Sci, 2020, 24(17):8767-8777.
[21]	Tortella GR, Rubilar O, Durán N, et al. Silver nanoparticles: Toxicity in model organisms as an overview of its hazard for human health and the environment[J]. J Hazard Mater, 2020,390:121974.
[22]	Chang XR, Niu SY, Shang MT, et al. ROS-Drp1-mediated mitochondria fission contributes to hippocampal HT22 cell apoptosis induced by silver nanoparticles[J]. Redox Biol, 2023,63:102739.
[23]	Noga M, Milan J, Frydrych A, et al. Toxicological aspects, safety assessment, and green toxicology of silver nanoparticles (AgNPs)-critical review: state of the art[J]. Int J Mol Sci, 2023, 24(6):5133.
[24]	Skvortsov AN, Ilyechova EY, Puchkova LV. Chemical background of silver nanoparticles interfering with mammalian copper metabolism[J]. J Hazard Mater, 2023,451:131093.
[25]	Sim W, Barnard RT, Blaskovich MAT, et al. Antimicrobial silver in medicinal and consumer applications: a patent review of the past decade (2007-2017)[J]. Antibiotics, 2018, 7(4):93.
[26]	Shehata AM, Salem FMS, El-Saied EM, et al. Evaluation of the ameliorative effect of zinc nanoparticles against silver nanoparticle-induced toxicity in liver and kidney of rats[J]. Biol Trace Elem Res, 2022, 200(3):1201-1211.
[27]	Wen L, Li MY, Lin XJ, et al. AgNPs aggravated hepatic steatosis, inflammation, oxidative stress, and epigenetic changes in mice with NAFLD induced by HFD[J]. Front Bioeng Biotechnol, 2022,10:912178.
[28]	Hogg SJ, Beavis PA, Dawson MA, et al. Targeting the epigenetic regulation of antitumour immunity[J]. Nat Rev Drug Discov, 2020, 19(11):776-800.
[29]	Farooqi AA, Fuentes-Mattei E, Fayyaz S, et al. Interplay between epigenetic abnormalities and deregulated expression of microRNAs in cancer[J]. Semin Cancer Biol, 2019,58:47-55.
[30]	Chung FF, Herceg Z. The promises and challenges of toxico-epigenomics: environmental chemicals and their impacts on the epigenome[J]. Environ Health Perspect, 2020, 128(1):15001.
[31]	Wu HT, Eckhardt CM, Baccarelli AA. Molecular mechanisms of environmental exposures and human disease[J]. Nat Rev Genet, 2023, 24(5):332-344.
[32]	Gao M, Zhao BB, Chen MJ, et al. Nrf-2-driven long noncoding RNA ODRUL contributes to modulating silver nanoparticle-induced effects on erythroid cells[J]. Biomaterials, 2017,130:14-27.
[33]	Ghafouri-Fard S, Esmaeili M, Taheri M, et al. Highly upregulated in liver cancer (HULC): an update on its role in carcinogenesis[J]. J Cell Physiol, 2020, 235(12):9071-9079. doi: 10.1002/jcp.29765 pmid: 32372477
[34]	Chen X, Song D. LPS promotes the progression of sepsis by activation of lncRNA HULC/miR-204-5p/TRPM7 network in HUVECs[J]. Biosci Rep, 2020, 40(6):BSR20200740.
[35]	Liu AM, Sun YQ, Wang XJ, et al. DNA methylation is involved in pro-inflammatory cytokines expression in T-2 toxin-induced liver injury[J]. Food Chem Toxicol, 2019,132:110661.
[36]	Zhang Y, Xue WL, Zhang WQ, et al. Histone methyltransferase G9a protects against acute liver injury through GSTP1[J]. Cell Death Differ, 2020, 27(4):1243-1258. doi: 10.1038/s41418-019-0412-8 pmid: 31515511
[37]	Zhou C, Huang C, Wang J, et al. LncRNA MEG3 downregulation mediated by DNMT3b contributes to nickel malignant transformation of human bronchial epithelial cells via modulating PHLPP1 transcription and HIF-1α translation[J]. Oncogene, 2017, 36(27):3878-3889. doi: 10.1038/onc.2017.14 pmid: 28263966

基因	上游引物（5′-3′）	下游引物（5′-3′）
lncRNA HULC	AACAGACCAAAGCATCAAGCAA	CAAATTTGCCACAGGTTGAACAC
HOTAIRM1	GAACTGGCGAGAGGACGAAT	GTGGGGACTATGGCTGGTTT
H19	GAACTGGCGAGAGGACGAAT	GTGGGGACTATGGCTGGTTT
MALAT1	TTTGTTCATTTCTGGTGGTGGG	TAAGACCAAGGGAGGGGAGAG
TET1	GCCTCCATCAGACGAACCCCTAT	ACTCAATCAAAACCGAGCCGTG
TET2	GGAAGCCAGAATAGTCGTGTGAGTC	TCTGAAGGAGCCCAGAGAGAGAAG
TET3	AGCGCTAAAGCAAGGAAAGA	AAGCAAGTCTGGCTGGGTTT
GAPDH	GGAGTCAACGGATTTGGTCGTATTG	TCTCGCTCCTGGAAGATGGTGAT

细胞名称	siRNA序列（5′-3′）
si-NC	UUCUCCGAACGUGUCACGUdTdT
si-TET1-1	GGGCACAAUACAACAGAAAdTdT
si-TET1-2	GCAAAUCAACAGGAAGUUUCUdTdT
si-TET1-3	CAGUGUAACCAGCACAGUUdTdT

AgNPs浓度（μg/mL）	HULC	HOTAIRM1	H19	MALAT1
0	1.00±0.06	1.00±0.13	1.00±0.06	1.00±0.04
5	0.80±0.07	0.92±0.06	0.58±0.08^*	1.06±0.09
10	0.99±0.05	1.06±0.04	0.60±0.07^*	0.99±0.07
20	2.68±0.30^*	0.20±0.03^*	0.70±0.04^*	1.10±0.04

组别	HULC	HOTAIRM1	H19
AgNPs	1.00±0.09	1.00±0.09	1.00±0.03
AgNPs+5-azaC	2.05±0.24	1.16±0.12	0.86±0.05
AgNPs+TSA	7.25±0.80^*	1.19±0.18	0.46±0.03^*

AgNPs浓度（μg/mL）	TET1	TET2	TET3
0	1.00±0.28	1.00±0.07	1.00±0.01
5	0.82±0.04	0.86±0.06	0.73±0.12
10	1.33±0.31	1.20±0.14	2.01±0.02
20	4.86±1.29^*	1.15±0.13	25.87±3.92^*